2.1. Experimental Animals

Natriuretic peptide receptor 1 (NPR1) gene-targeted mice were obtained from the Jackson Laboratory (Bar Harbor, ME 04609, USA, Stock no. 004374). The mutant line was originally generated on a 129 background and subsequently backcrossed onto the C57BL/6 background for more than eight generations. Homozygous NPR1 knockout (KO), heterozygous (NPR1^+/−), and wild-type (WT) littermates were produced by in-house breeding of a colony maintained in our institutional animal facility. Both male and female mice aged 12 weeks were used, with sex balanced across experimental groups. All procedures were approved by the Institutional Animal Care and Use Committee and conducted in accordance with NIH guidelines.

2.2. Caloric Restriction Protocol

Caloric restriction (CR) was implemented as described [33]. Twelve-week-old mice were fed the #2018 rodent diet ad libitum (AL) for one week to establish baseline food intake. Average daily consumption during this period was used to calculate caloric allocation for the caloric restriction (CR) group. Mice were then randomly assigned to AL or CR groups. AL mice continued to receive food ad libitum, whereas CR mice were fed 20% less than AL intake for two weeks, followed by 40% less for an additional two weeks. CR mice received their daily food allotment at 5:00 p.m. Food allocation was adjusted weekly based on consumption in the AL group. When indicated, transverse aortic constriction (TAC) was performed during the second week of the caloric restriction (CR) protocol. At study completion, cardiac function was assessed by echocardiography. Mice were subsequently euthanized, blood was collected, and hearts were rapidly excised, rinsed in cold saline, weighed, and sectioned for downstream analyses.

2.3. Transverse Aortic Constriction (TAC)

To induce pressure overload, mice underwent transverse aortic constriction (TAC) surgery under inhalational anesthesia (1.5–2.5% isoflurane in 1 L/min oxygen). Body temperature was continuously monitored using a rectal thermometer and maintained with a heating platform. A 27-gauge needle was placed adjacent to the transverse aorta between the innominate and left common carotid arteries, and a 7-0 silk suture was tied securely around both the needle and the aorta. The needle was then removed to create a standardized constriction. Sham-operated mice underwent the same surgical procedure without aortic ligation. Postoperative analgesia was provided by intraperitoneal administration of buprenorphine (0.1 µg/g body weight).

2.4. Echocardiography

Transthoracic echocardiography was performed at baseline and 4 weeks after TAC under anesthesia (3% isoflurane induction, 1.5% maintenance) using a high-resolution ultrasound system (Vevo 2100, VisualSonics, Toronto, ON M4N3N1, Canada) as described previously [33]. Left ventricular (LV) end-diastolic diameter (LVEDD), end-systolic diameter (LVESD), fractional shortening (FS), and ejection fraction (EF) were measured from 2-D short-axis M-mode tracings at the level of the papillary muscle. All analyses were performed by investigators blinded to genotype and treatment.

2.5. Histology and Morphometry

Immediately after harvest, a mid-ventricular myocardial slice was fixed in 4% (w/v) paraformaldehyde overnight, embedded in paraffin, and sectioned at 5 µm by the Histology Core at the Burnham Institute for Medical Research (La Jolla, CA, USA). Fibrosis was assessed by Masson’s trichrome staining. High-resolution images were acquired using the Aperio Scanscope system (Burnham Institute, La Jolla, CA, USA), and cardiac fibrosis was quantified using ImageJ 2.0.0-beta-7 (NIH). For cardiomyocyte cross-sectional area analysis, a separate mid-ventricular myocardial slice was embedded in OCT compound (Sakura Finetek, Inc. Torrance, CA 90501, USA). Frozen ventricular sections (5 µm) were stained with wheat germ agglutinin (WGA; Sigma-Aldrich, St. Louis, MO, USA) to delineate cardiomyocyte membranes and Alexa Fluor 488–conjugated isolectin IB4 (Thermo Fisher Scientific, Waltham, MA, USA) to label capillaries. Images were captured at 400× magnification using an FV1000 confocal microscope (Olympus, Tokyo 192-8507, Japan). Cardiomyocyte cross-sectional areas were quantified using ImageJ from 4–5 regions per heart, encompassing at least 1000 cardiomyocytes per heart.

2.6. ATP Measurement

Myocardial ATP content was measured using a luciferase-based ATP determination kit (Thermo Fisher). Cardiac tissue samples were homogenized in ice-cold assay buffer according to the manufacturer’s instructions, and ATP levels were quantified by luminescence. Values were normalized to total protein concentration.

2.7. cGMP Assay

Tissue cyclic GMP (cGMP) levels were measured using a cGMP complete ELISA kit (Enzo Life Sciences, Farmingdale, NY, USA). Hearts were rapidly excised, snap‑frozen in liquid nitrogen, and pulverized to preserve endogenous cGMP. The powdered tissue was homogenized in 0.1 M HCl to inactivate phosphodiesterases and prevent cGMP degradation. After centrifugation, supernatants were collected and processed according to the manufacturer’s instructions. The absorbances were read at 405 nm using a SynergyTM Mx multi-mode microplate reader from BioTek (Winooski, VT, USA). The concentrations were calculated based on a standard curve generated at the same time.

2.8. Nitric Oxide (NO) Assay

Nitric oxide (NO) levels were measured using the Abcam Nitric Oxide Assay Kit (ab272517). Because NO rapidly oxidizes to nitrite (NO₂⁻) and nitrate (NO₃⁻), total nitrite/nitrate was quantified as an index of NO production. Nitrate was enzymatically reduced to nitrite, followed by colorimetric detection using the Griess reaction. Absorbance was read at 540 nm, and NO levels were calculated from a sodium nitrite standard curve.

2.9. sGC Assay

Soluble guanylate cyclase (sGC) levels were quantified using a mouse soluble guanylate cyclase subunit α‑3 ELISA kit (MyBioSource, San Diego, CA, USA). Tissue samples were processed according to the manufacturer’s instructions, and sGC concentrations were calculated from a standard curve generated in parallel.

2.10. Western Blot Analyses

Protein expression was assessed by immunoblotting using standard procedures. Briefly, heart tissues were homogenized in ice-cold RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Roche, Basel, Switzerland). Lysates were clarified by centrifugation at 12,000× g for 15 min at 4 °C, and protein concentrations were determined using a BCA assay (Thermo Fisher Scientific). Equal amounts of protein (20–40 µg) were resolved on SDS–polyacrylamide gels and transferred onto PVDF membranes (Millipore, Burlington, MA, USA). Membranes were blocked for 1 h at room temperature in Tris-buffered saline containing 0.1% Tween-20 (TBST) and 5% non-fat dry milk, as indicated. Membranes were then incubated overnight at 4 °C with primary antibodies diluted in blocking buffer.

The following primary antibodies were used: CHOP, BiP, protein disulfide isomerase (PDI), PERK, IRE1α, and GAPDH (all from Cell Signaling Technology, Danvers, MA, USA; typically 1:1000 for target proteins and 1:50,000 for GAPDH); Atp5g2, cytochrome c oxidase subunit IV (Cox IV), cytochrome b5 (Cytb5), optic atrophy 1 (Opa1), atrial natriuretic peptide (ANP), and natriuretic peptide receptor-A (NPR-A/NPR1) (Abcam, Cambridge, UK; typically 1:1000); dynamin-related protein 1 (Drp1) (Santa Cruz Biotechnology, Dallas, TX, USA; 1:500–1:1000); and oxidative stress markers 4-hydroxynonenal (4-HNE) and nitrotyrosine (Millipore; 1:1000). CHOP (~29 kDa), BiP (~75 kDa), PDI (~57 kDa), PERK (~120–140 kDa), IRE1α (~110–130 kDa), eNOS and phospho-eNOS (Ser1177; ~135 kDa), Drp1 (~80 kDa), Cox IV (~17 kDa), Cytb5 (~15 kDa), and Atp5g2 (~9 kDa) were detected at their expected molecular weights. Opa1 appeared as multiple bands (~90–110 kDa) corresponding to long and short isoforms. Oxidized proteins, 4-HNE and nitrotyrosine immunoblots showed multiple bands reflecting protein adduct formation.

After primary antibody incubation, membranes were washed three times with TBST and incubated for 1 h at room temperature with appropriate horseradish peroxidase–conjugated secondary antibodies (anti-rabbit or anti-mouse IgG; Jackson ImmunoResearch, West Grove, PA, USA) diluted 1:5000 in blocking buffer. Immunoreactive bands were visualized using enhanced chemiluminescence (ECL; Thermo Fisher Scientific) and imaged with a ChemiDoc imaging system 3000 (Bio-Rad, Hercules, CA, USA).

Band intensities were quantified using ImageJ software (NIH). Target protein expression was normalized to GAPDH whose expression is not changed across genotypes and dietary conditions in this study.

2.11. Oxidative Stress and ER Stress Assays

Protein carbonyl content in the heart homogenates was measured by Western blot analysis using the Oxyblot™ Protein Oxidation Detection Kit (S7150, Chemicon, Temecula, CA, USA), based on immunochemical detection of protein carbonyl groups derived from 2,4-dinitrophenyl hydrazine [33]. Lipid peroxidation and protein nitration were evaluated by standard Western blotting procedure using 4-Hydroxynonenal (4-HNE) and 3-Nitrotyrosine (3-NT) antibodies respectively. ER stress markers (CHOP, GRP78 or BiP, PDI, PERK and IRE1α) were measured by Western blot analyses.

2.12. RNA isolation, RT, and Quantitative PCR Analyses

Total RNA was isolated using the TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the recommendations of the manufacturer. A total of 1 μg RNA from each sample was used for RT using TaqMan^® Reverse Transcription Reagents (Invitrogen). The cDNA was diluted by 10 using ddH2O and used for quantitative PCR analysis (Invitrogen). The primer sequences are as follows. ANP forward: ATGGGCTCCTTCTCCATCA, and reverse GGAAGCTGTTGCAGCCTAGT; BNP forward: AAGGTGCTGTCCCAGATGATT, and reverse: TTCAGTGCGTTACAGCCCAAA; GAPDH forward: AAGGTCATCCCAGAGCTGAAC, and reverse: TCATTGAGAGCAATGCCAGCC. Gene expression was quantified by GelDoc XR+ imaging system (Bio-Rad).

2.13. Statistical Analysis

Data are presented as mean ± SEM. Comparisons among multiple groups were performed using two-way ANOVA with genotype and diet as factors, followed by Bonferroni post hoc testing to correct for multiple comparisons, as implemented in GraphPad Prism 6. A two-tailed p value < 0.05 was considered statistically significant. Some analyses may not have been powered to detect small effect sizes, including potential haploinsufficiency; therefore, negative findings should be interpreted with appropriate caution.

3.1. CR is Sufficient to Attenuate Pressure Overload-Induced Cardiac Remodeling and Functional Impairment in Wild Type C57/6 Mice

To confirm the ability of caloric restriction (CR) to modulate the cardiac remodeling response, wild-type C57BL/6 mice were subjected to CR for 4 weeks (20% and 40% food reduction, each applied for 2 weeks), with transverse aortic constriction (TAC) performed during week 2. Following TAC, mice fed ad libitum (AL) developed robust left ventricular (LV) hypertrophy, as evidenced by a 42% increase in the heart weight-to-body weight (HW/BW) ratio compared with sham controls (Figure 1A, p < 0.01). CR significantly blunted the TAC-induced hypertrophic response, limiting the increase in HW/BW to 18% (Figure 1A, p < 0.05 vs. AL).

Figure 1. Caloric restriction attenuates TAC-induced cardiac remodeling. WT C57BL/6 mice were subjected to a caloric restriction (CR) regimen consisting of a 20% caloric reduction for 2 weeks followed by a 40% reduction for an additional 2 weeks. Transverse aortic constriction (TAC) was performed during week 2 of the CR protocol. (A) Heart weight–to–body weight ratio (n = 11–15; p values indicated). (B) Left ventricular fractional shortening (LV FS%) (n = 11–13; p values indicated). (C) Cardiac fibrosis assessed by Masson’s trichrome staining (n = 5; p values indicated). (D) Cardiomyocyte cross-sectional area and capillary density (n = 5; p values indicated). (E) Oxidative stress markers. (F) Western blot analysis of endoplasmic reticulum (ER) stress markers (n = 6). Data are presented as mean ± SEM and were analyzed by two-way ANOVA. * p < 0.05, ** p < 0.01 vs. Sham-AL; # p < 0.05, ## p < 0.01 vs. TAC-AL. Scale bars: (C) (upper), 500 µm; (C) (lower), 50 µm; (D), 20 µm.

Echocardiographic analysis further demonstrated that TAC significantly reduced LV fractional shortening (FS) in AL mice, whereas CR preserved systolic function (Figure 1B; 33 ± 2% vs. 26 ± 3%, p < 0.05). Consistent with these functional changes, Masson’s trichrome staining revealed marked interstitial and perivascular fibrosis in TAC hearts from AL mice (Figure 1C, fibrotic area: 12 ± 1% vs. 4 ± 1% in sham, p < 0.01), which was significantly attenuated by CR (6 ± 1%, p < 0.05 vs. AL). In addition, TAC increased cardiomyocyte cross-sectional area and reduced capillary density, both of which were partially reversed by CR (Figure 1D).

At the molecular level, Western blot analyses showed that TAC markedly increased oxidative stress, as indicated by elevated levels of oxidized protein carbonyls, 4-hydroxynonenal, and nitrotyrosine (Figure 1E). CR significantly reduced these oxidative stress markers in TAC hearts. Markers of endoplasmic reticulum (ER) stress, including CHOP, BiP, PDI, PERK, and IRE1α, were also markedly induced by TAC (Figure 1F). CR blunted the induction of these ER stress markers.

Collectively, these results demonstrate that CR is sufficient to attenuate pressure overload-induced cardiac remodeling and functional impairment in mice, and that these protective effects are associated with reduced oxidative stress and ER stress.

3.2. CR Does Not Attenuate Established Cardiac Remodeling in NPR1 Deficient Mice

Genetic ablation of NPR1 in mice leads to cardiac hypertrophy and interstitial fibrosis [38,39,40]. Given the ability of CR to attenuate TAC-induced cardiac remodeling (Figure 1), we hypothesized that CR might also mitigate cardiac remodeling in NPR1 deficient mice. As shown in Figure 2, no significant difference was observed between WT and NPR1^+/− mice in HW/BW ratio (Figure 2A), fractional shortening (FS, Figure 2C), ejection fraction (EF, Figure 2B), left ventricular end-systolic diameter (LVESD, Figure 2D), or fibrosis (Figure 2E). In contrast, NPR1 KO mice exhibited marked cardiac hypertrophy and fibrosis accompanied by impaired cardiac function compared with WT mice.

However, in contrast to its effects on TAC-induced cardiac hypertrophy, CR neither attenuated nor reversed established cardiac remodeling in NPR1 KO mice, as none of the measured parameters differed significantly between ad libitum (AL)- and CR-fed KO animals. Collectively, these findings indicate that, unlike its protective effects against TAC-induced cardiac remodeling, CR is ineffective in mitigating cardiac remodeling driven by NPR1 deficiency. Because NPR1 KO mice develop a congenital, developmentally programmed cardiomyopathy prior to the initiation of CR, these results reflect an inability of CR to reverse established disease rather than a failure to prevent disease onset.

3.3. CR Reduces Oxidative Stress and ER Stress Independent of NPR1

Western blot analyses revealed markedly increased oxidative stress in NPR1 KO hearts, as indicated by elevated levels of oxidized protein carbonyls, 4-hydroxynonenal, and nitrotyrosine, reflecting oxidative damage (Figure 3A). Notably, CR significantly reduced these oxidative stress markers in WT, NPR1^+/−, and NPR1 KO mice alike.

ER stress markers, including CHOP, BiP, PDI, PERK, and IRE1α, were also markedly elevated in NPR1 KO hearts (Figure 3B). CR blunted the induction of these ER stress markers across all genotypes, indicating that the stress-reducing effects of CR occur independently of NPR1.

Collectively, these findings demonstrate that although CR robustly suppresses oxidative and ER stress regardless of NPR1 status, these adaptive responses alone are insufficient to prevent cardiac remodeling in NPR1-deficient mice.

Figure 2. Caloric restriction fails to mitigate established cardiac remodeling in NPR1-deficient mice. NPR1 KO, heterozygous^+/− mice and WT littermates were subjected to caloric restriction (CR; 20% reduction relative to ad libitum [AL] feeding for 2 weeks, followed by 40% reduction for an additional 2 weeks) for a total of 4 weeks. (A) Heart weight-to-body weight ratio (n = 7–9; p values indicated). (B) Left ventricular ejection fraction (LV EF%) (n = 7–9; p values indicated). (C) Left ventricular fractional shortening (LV FS%) (n = 7–9; p values indicated). (D) Left ventricular end-systolic diameter (LVESD) (n = 7–9; p values indicated). (E) Cardiac fibrosis (n = 5; p values indicated). Data are presented as mean ± SEM and were analyzed by two-way ANOVA. Scale bars: (E) (upper), 500 µm; (E) (lower), 50 µm.

Figure 3. Caloric restriction reduces cardiac oxidative and endoplasmic reticulum (ER) stress in NPR1-deficient mice. NPR1 KO, heterozygous^+/− mice and WT littermates were subjected to a caloric restriction (CR) regimen (20% caloric reduction for 2 weeks followed by 40% reduction for an additional 2 weeks). (A) Western blot analysis of oxidative stress markers, including protein carbonyls (upper), nitrotyrosine (middle), and 4-hydroxynonenal (lower). (B) Western blot analysis of ER stress-related proteins, including CHOP, BiP, PDI, PERK, and IRE1α. Data are presented as mean ± SEM and were analyzed by two-way ANOVA (n = 4). * p < 0.05, ** p < 0.01 vs. WT-AL; # p < 0.05, ## p < 0.01 vs. NPR1^+/−-AL.

3.4. CR Preserves Myocardial ATP Content Independent of NPR1

ATP content was significantly reduced in NPR1 KO hearts compared with WT and NPR1^+/− hearts. Interestingly, CR reduced ATP levels in WT and NPR1^+/− hearts but did not further decrease ATP content in NPR1 KO hearts. Instead, ATP levels in NPR1 KO mice were higher under ad libitum (AL) feeding than under CR (Figure 4A), a pattern associated with preserved expression of the mitochondrial ATP synthase subunit ATP5G2 (Figure 4B). These findings suggest that, despite persistent hypertrophy and cardiac dysfunction, myocardial ATP levels are maintained in NPR1-deficient mice under CR. Together, these results indicate that CR preserves myocardial energetics through NPR1-independent mechanisms, potentially via enhanced mitochondrial efficiency and reduced metabolic demand.

3.5. cGMP Signaling Is Severely Impaired in NPR1 KO Mice Despite CR

To directly assess downstream signaling, myocardial cGMP levels were measured across genotypes and dietary conditions. CR increased cGMP content by approximately 20% in both WT and NPR1^+/− hearts compared with ad libitum (AL) feeding. In contrast, NPR1 knockout (KO) mice exhibited profoundly reduced basal cGMP levels (~90% reduction compared with WT), which were not restored by CR (Figure 5A). This persistent loss of cGMP signaling in NPR1 KO hearts correlated with the absence of CR-mediated antihypertrophic and antifibrotic effects, supporting a context-dependent requirement for intact NPR1-cGMP signaling in mediating CR-associated suppression of pathological remodeling.

3.6. ANP and BNP Are Upregulated in NPR1 KO Mice

Western blot analyses revealed an approximately 2.5-fold increase in atrial natriuretic peptide (ANP) protein levels in NPR1 KO mice compared with WT controls (p < 0.01). CR increased ANP protein expression by ~40% in both WT and NPR1^+/− hearts and further elevated ANP levels in NPR1 KO hearts, likely reflecting a compensatory feedback upregulation of natriuretic peptide synthesis in response to impaired downstream signaling (Figure 5B).

Consistent with these findings, reverse transcription-polymerase chain reaction (RT-PCR) analyses demonstrated significantly increased ANP mRNA expression in NPR1 KO hearts, which was further augmented by CR. Similarly, BNP mRNA levels were markedly elevated in NPR1 KO hearts and were further induced by CR (Figure 5C). Together, these results suggest that natriuretic peptide expression is strongly upregulated in response to NPR1 deficiency and CR; however, in the absence of functional NPR1-cGMP signaling, this compensatory increase in ANP and BNP is insufficient to confer cardioprotection.

Figure 4. CR Preserves Myocardial ATP Content Independent of NPR1. NPR1 KO, heterozygous^+/− mice and WT littermates were subjected to a caloric restriction (CR) regimen consisting of a 20% caloric reduction for 2 weeks followed by a 40% reduction for an additional 2 weeks. (A) Myocardial ATP content measured using a luciferase-based ATP determination assay. Data were analyzed by two-way ANOVA (n = 8); p values are indicated in the graph. (B) Western blot analysis of proteins involved in the regulation of mitochondrial function and dynamics. Quantification of ATP5G2 protein levels is presented as mean ± SEM and was analyzed by two-way ANOVA (n = 4); p values are indicated in the graph.

Figure 5. NPR1 deficiency reduces cardiac cGMP levels and enhances ANP expression. NPR1 KO, heterozygous^+/− mice and WT littermates were subjected to a caloric restriction (CR) regimen consisting of a 20% caloric reduction for 2 weeks followed by a 40% reduction for an additional 2 weeks. (A) Cardiac cGMP levels measured using a complete cGMP ELISA kit (Enzo Life Sciences, Farmingdale, NY). Data were analyzed by two-way ANOVA (n = 6–8; p values indicated). (B) Western blot analysis of ANP. Data are presented as mean ± SEM and were analyzed by two-way ANOVA (n = 4; p values indicated). (C) ANP and BNP mRNA expression assessed by RT-PCR. Data are presented as mean ± SEM and were analyzed by two-way ANOVA (n = 4; p values indicated).

3.7. Compensatory Activation of NO-sGC Signaling in NPR1 KO Mice

The total amounts of nitrite (NO₂⁻) and nitrate (NO₃⁻) were significantly increased in NPR1 KO hearts (Figure 6A), suggesting an enhanced production of nitric oxide (NO). In parallel, expression of soluble guanylyl cyclase (sGC) was upregulated (Figure 6B), suggesting a compensatory attempt to restore cGMP signaling through the NO-sGC pathway. Despite these adaptations, myocardial cGMP levels remained profoundly reduced. Thus, although CR engages compensatory NO-sGC signaling in NPR1 KO mice, this response is insufficient to restore cGMP signaling or prevent pathological cardiac remodeling.

Figure 6. NPR1 knockout increases cardiac NO and soluble guanylyl cyclase signaling. NPR1 KO, heterozygous (NPR1^+/−), and WT littermate mice were subjected to a caloric restriction (CR) regimen consisting of a 20% caloric reduction for 2 weeks followed by a 40% reduction for an additional 2 weeks. (A) Cardiac nitric oxide (NO) levels measured using a nitric oxide assay kit (Abcam, San Francisco, CA, USA). Data are presented as mean ± SEM and were analyzed by two-way ANOVA (n = 6–8; p values indicated). (B) Cardiac soluble guanylyl cyclase (sGC) levels measured using a mouse soluble guanylate cyclase subunit alpha-3 ELISA kit (MyBioSource, San Diego, CA). Data are presented as mean ± SEM and were analyzed by two-way ANOVA (n = 6–8; p values indicated).

4.1. NPR1 as a Central Node in CR-Mediated Cardioprotection

CR exerts broad systemic and cellular effects, including improved mitochondrial efficiency, enhanced autophagy, reduced ROS generation, and suppression of nutrient-sensitive pathways such as mTOR. These adaptations are thought to provide redundant layers of protection against pathological remodeling. Our findings, however, reveal that the antihypertrophic and antifibrotic effects of CR are critically dependent on NPR1 signaling, even when oxidative stress, ER stress, and ATP content are favorably regulated. The requirement for NPR1 likely reflects its unique role in directly modulating cardiomyocyte growth and fibroblast activity. NPR1-cGMP-PKG signaling inhibits calcineurin-NFAT, MAPK, and hypertrophic transcriptional programs, while simultaneously suppressing profibrotic TGF-β/Smad signaling. These pathways converge on gene expression programs that govern hypertrophy and extracellular matrix deposition, outcomes that cannot be fully mitigated by improved mitochondrial energetics or reduced oxidative burden alone. This hierarchy suggests that CR’s activation of energy-sensing pathways (e.g., AMPK, sirtuins) and stress resistance mechanisms provides a supportive environment, but NPR1 signaling is required to directly suppress the maladaptive transcriptional responses to mechanical overload.

The natriuretic peptide receptor (NPR) family comprises NPR1 (GC-A), which primarily mediates ANP/BNP-induced cGMP production in the heart, NPR2 (GC-B), which preferentially responds to CNP, and NPR3, which functions largely as a clearance receptor. In this context, the potential roles of NPR2 and NPR3 in caloric restriction and NPR1 deficiency warrant brief discussion. Although compensatory changes in NPR2 or NPR3 could theoretically influence natriuretic peptide availability, the ~90% reduction in myocardial cGMP observed in NPR1 KO hearts strongly supports NPR1 as the dominant source of cardiomyocyte cGMP under these conditions. Accordingly, the observed phenotype is most consistent with loss of NPR1 signaling rather than redistribution within the natriuretic peptide receptor family, which remains an important area for future investigation.

Although heterozygous NPR1 KO (Npr1^+/−) mice have been reported to exhibit impaired renal and metabolic responses under stress [46], we did not observe a significant cardiac phenotype in Npr1^+/− mice compared with wild-type controls. Across all measured parameters, including NPR1 protein abundance, myocardial cGMP levels, and ANP protein levels (Figure 5), Npr1^+/− mice were indistinguishable from wild-type mice, indicating preserved NPR1 signaling and no evidence of cardiac haploinsufficiency under baseline and CR conditions. Because these studies were performed in young adult mice (12 weeks old), age- or stress-dependent haploinsufficiency in older animals cannot be excluded.

4.2. Dissociation of Oxidative/ER Stress from Cardiac Remodeling

A critical observation in our data is the dissociation between "stress markers" and "structural remodeling". CR robustly reduced protein carbonyls, 4-hydroxynonenal (4-HNE), and nitrotyrosine levels, and blunted the induction of ER stress markers (CHOP, BiP, PERK) in all genotypes, including the NPR1 KO. While oxidative and ER stress are often cited as primary drivers of cardiac pathology, our results indicate that suppressing these factors is insufficient to prevent remodeling if cGMP signaling is absent. This suggests that while CR creates a more favorable intracellular environment, the “stop signal” for hypertrophic gene programs and fibroblast activation requires the NPR1-cGMP pathway. In the absence of NPR1, the heart remains committed to a remodeling program despite a significant reduction in proteotoxic and oxidative stress.

4.3. Energetic Preservation and Mitochondrial Efficiency

Our analysis of myocardial energetics revealed that CR preserved ATP content and ATP5G2 expression in NPR1 KO hearts. Interestingly, CR typically lowers ATP levels in WT hearts, a reflection of shifted metabolic demand, but in the KO heart, ATP levels remained relatively stable. This suggests that CR enhances mitochondrial efficiency or reduces metabolic demand independently of NPR1. However, the preservation of energy stores was not enough to rescue function, reinforcing the idea that the failure of the NPR1 KO heart is a signaling failure rather than a simple fuel shortage.

4.4. Impaired cGMP Generation as a Major Signaling Limitation

The profound reduction in myocardial cGMP levels (~90%) in NPR1 KO mice appears to represent a critical barrier to CR-mediated protection. In these hearts, we observed a compensatory upregulation of ANP and BNP at both mRNA and protein levels, accompanied by increased NO production and sGC expression (Figure 6). These responses suggest that the myocardium senses the loss of cGMP and attempts to compensate through enhanced ligand production and activation of the NO-sGC pathway. Despite these compensatory efforts, myocardial cGMP levels remained critically low and were not restored by CR.

At first glance, this finding may appear unexpected in light of prior studies demonstrating an essential role for eNOS/NO signaling in CR-mediated protection against ischemia-reperfusion cardiac injury [47] and ischemic limb muscle damage [48]. To reconcile our results with these reports, it’s possible that our analyses of whole-heart lysates may dilute endothelial eNOS-derived signals. Nevertheless, we observed consistent trends toward increased NO production in CR-treated WT hearts (Figure 6A,B), although these did not reach statistical significance; importantly, this should not be interpreted as a lack of biological relevance. Instead, our findings support the concept that NPR1-derived and NO-derived cGMP pools fulfill distinct and non-redundant roles in CR-induced cardioprotection, revealing a major signaling limitation at the level of NPR1-dependent cGMP generation.

Finally, although impaired NPR1-derived cGMP synthesis appears central, we cannot exclude additional contributing mechanisms, including enhanced cGMP degradation via PDE5 or PDE9, altered compartmentalized cGMP signaling, or reduced downstream PKG activation [49].

4.5. Translational Implications

In humans, NPR1 function varies widely due to genetic, metabolic, and environmental factors, and impaired natriuretic peptide signaling is common in obesity, hypertension, and HFpEF, conditions in which CR and dietary interventions are increasingly applied [15,21,22].

If intact NPR1 signaling is required for the full cardioprotective effects of CR, individuals with reduced NPR1 activity may derive diminished benefit, potentially contributing to heterogeneous responses observed in clinical lifestyle studies. These findings further suggest that pharmacologic enhancement of NPR1 signaling, such as neprilysin inhibition, designer natriuretic peptides, or NPR1 agonists, may synergize with CR to maximize cardiovascular benefit. Indeed, sacubitril/valsartan (Entresto) has demonstrated robust reductions in cardiovascular mortality and heart failure hospitalization in landmark trials, supporting the efficacy and safety of increasing ANP/BNP by neprilysin inhibition [50,51,52].

Finally, the inability of NO-sGC signaling to compensate for NPR1 loss underscores the specificity and nonredundancy of natriuretic peptide pathways in suppressing cardiac hypertrophy, indicating that therapeutic strategies should prioritize direct reinforcement of NPR1 signaling rather than relying solely on NO-based approaches.

4.6. Limitations of The Study

While our study provides evidence that NPR1 is essential for the cardioprotective effects of CR, several limitations should be considered when interpreting these findings. First, the CR protocol used here was relatively short-term (4 weeks). Longer CR interventions may elicit additional adaptations that could partially compensate for NPR1 deficiency. However, the profound remodeling observed in NPR1 KO mice suggests that even chronic CR would be insufficient without NPR1 signaling. Importantly, this study did not include NPR1 KO mice subjected to TAC under CR, which would be required to definitively test the necessity of NPR1 signaling in CR-mediated protection against acute pressure overload. Additionally, diastolic function was not assessed, and fractional shortening may not fully capture functional impairment, particularly in NPR1-deficient hearts. Negative findings in NPR1 KO mice should therefore be interpreted cautiously, as the study was not powered to detect small-to-moderate improvements in established diseases.

Second, this study employed global NPR1 knockout mice, which limits our ability to distinguish cardiomyocyte-specific effects from those arising in non-myocyte populations, such as cardiac fibroblasts. Future studies using cell type-specific NPR1 deletion models will be necessary to delineate the relative contributions of NPR1 signaling in cardiomyocytes versus fibroblasts during cardiac remodeling. Moreover, the use of a global knockout model precludes definitive separation of the direct cardiac effects of caloric restriction (CR) from its systemic actions on other organs. Because NPR1 is also expressed in the vasculature and kidneys, loss of NPR1 in these tissues may promote systemic hypertension or altered volume regulation, which likely contributes to the observed cardiac phenotype. Such systemic effects may, in turn, mask potential cell-autonomous protective actions of CR within cardiomyocytes themselves.

Third, while we measured total cellular cGMP, we did not assess subcellular cGMP pools using advanced imaging techniques. Such studies could confirm the compartmentalized nature of NPR1 versus sGC signaling [53].

Another important consideration in interpreting these findings is the fundamental difference between the pathological models examined. TAC in WT mice represents an acute hemodynamic stress imposed on a previously healthy heart, whereas NPR1 deficiency produces chronic, developmentally established cardiomyopathy with limited reversibility. As such, direct equivalence between these models should be avoided, and our conclusions are best interpreted as demonstrating the ability of CR to reduce acute cardiac remodeling where the NPR1 signaling is intact rather than an absolute requirement for all forms of cardioprotection.

Finally, the translational extrapolation to humans must be made cautiously. Human CR regimens are heterogeneous, and genetic variation in NPR1 expression or natriuretic peptide levels may modulate responses. Clinical studies incorporating biomarkers of NP-NPR1 activity will be necessary to validate our findings in patient populations.